BiQ Analyzer Logo
max planck institut
informatik
mpii logo Minerva of the Max Planck Society
 

Guided Tour / Exemplary Analysis - Step 2 of 20

Back Next

Description: This is the main screen of BiQ Analyzer. Its main elements are the status indicator on the top left, the text box for the genomic sequence at the top, some parameter settings on the top right, an empty space for the input sequences on the left and an empty space for the multiple sequence alignment on the right. In addition - and most importantly - there is a message box at the bottom right, which will give you hints on how to proceed in each step. Please read these messages carefully - they will help you to understand how the program works. We will now proceed as suggested: first paste the genomic sequence into the text box at the top and then press the "Next" button. Importantly, the genomic sequence must not contain primers and must be unconverted!

Here's the genomic sequence that we use for this example:
CCCGGGATCGCTCTCCCAGCAGGTGAAGCCTCGCCATGGACCCTCCCCGTCGGGGCCCCG
CGCTGCCCCGCCCGCCCCCAGCCGCTGGCCAAGGCCGCGGTCGCGCAGGCGCAGTGCCG
CGTCCCGCCGCCGCCCCGCCCTGCCCGTCGCTGCGGAAGGCGCCGCGCGCAGCAACGCG
CACTTCCTCTCCAGGAATCCGCGGAGGGAGCGCAGGCTCGAAGAGCTCCTGGACG

Please press the "Next" link now in order to proceed to the next step.

Screenshot: